Monday, June 18, 2007

el mito del eterno retorno.

por acá es -oficial y felizmente- soda y police.
pero parece que también se le están prendiendo velitas sudamericanas al san progresivo-setentoso-misteriosamente-devenido-pop-aspen para que ellos también se animen al down under no angloparlante.
sólo basta chusmear un poco
sus foros... van a ver que hay campaña y todo.




todo vuelve. bandas que, como police, dieron media vuelta en la cima de su éxito. bandas que, como soda, cerraron el candado cuando sintieron que no daba para más, y se les empezaba a notar en el sonido. y ellos, los de la foto de ahí arriba, que fueron y vinieron y se reinventaron unas cuantas veces, con diferentes resultados.

para ser sincera, yo no soy una gran conocedora de genesis. pero debo admitir que escuchar temas de la época de peter gabriel (de cuya carrera solista sí soy bastante más fan) y confrontarlos con los de la época de phil collins (quien me parece un baterista de la recontra ostia.... pero no sé si mucho más que eso) me da como un ligero escozor. es como que un grandísimo actor de teatro shakespeariano o brechtiano o lorquiano (o cualquier grande) hubiera decidido transformarse en galán de telenovelas. seguro que su "arte" va a llegar a más gente, seguro que será más conocido y admirado, seguro que nunca más se morirá de hambre, pero.... a cambio de qué?

a veces me pregunto qué cosas llevan a un músico a dar un giro tan violento en su carrera; más allá de que, desde que collins se hizo cargo, hubo como una especie de transición. gracias a dios, and then there were three no puede compararse a we can't dance. pero, por otro lado, ninguno de los dos discos podrían compararse, ni en un millón de años, a -ponele- selling england by the pound. opiniones como estas me han traído aparejadas discusiones de lo más divertidas con mi muchacho, que disfruta sacudiendo los pelos con jesus he knows me, mientras que, cuando esto sucede, yo sólo puedo acordarme del capítulo de american psycho dedicado al review de invisible touch (entre descripciones de cuerpos horriblemente mutilados y comidas en restaurantes caros y cataratas de marcas de ropa.... ah, cómo amo ese libro... :P).

y también me pregunto qué era lo que ese músico -el del giro violento- quería originalmente. banks y rutherford (que, al fin y al cabo, son los que están ahi desde el vamos) son los del piano in-cre-í-ble de firth of fifth, o son los de la baladita liiindu de hold on my heart? o son las dos cosas? o primero quisieron una y, cuando se cansaron, prefirieron la otra? será la edad? será la cabeza quemada por el ultimate progressive?

parece que, en el setlist, los tipos cierran el concierto con i can't dance (aunque por suerte inmediatamente después se rescatan con the carpet crawlers). no sé, me pongo en los zapatos de un fan de genesis de la primera hora que los va a ver por primera vez en su hipotética gira sudamericana y creo que me agarraría una cierta indignación... o tal vez es simplemente que yo disfruto siendo una frigging snob. repito, no sé.


***

y como todo tiene que ver con todo, toda esta chorrera de opinión fue un pretexto para venir a postear aquí un "genesis de transición". justo de cuando gabriel y hackett dijeron: al caraho! y se fueron a regar las macetas de sus respectivas carreras solistas. tema recomendado por el gran ocalopez, y, nuevamente, un hallazgo (sé que lo había escuchado alguna vez, pero nunca hubiera pensado en versionarlo).

del disco and then there were three, de 1978, many too many. y no, no lo están tocando en este tour. lástima...

19 comments:

EMO said...

yo ví a phil collins en river hace un par de años. Recuerdo que fue lunes que la gente hacía la "ola" mexicana en el show. Estuvo muy bueno! Tengo muchos discos de él y genesis, obviamnete muchos de ellos están rayados, fueron mis primeros cd's

ocalopez said...

Hola!!!!!! Entrar a tu blog y ver esa fotito en la cabecera es ya suficiente para ponerme contento.

Comparto con vos la preferencia de la época Hackett-Grabriel de Genesis y "selling" es también el que más

me gusta. Igualmente en el caso hipotético de que hicieran una gira sudamericana los voy a ver aunque

tocaran solo el disco "we can't dance" y la bruja me eche de casa :D
Por último no puedo expresar la inmensa alegría que me da de que un tema no tan conocido y que siempre me haya gustado tanto, y que luego lo imaginé cantado por tu vos y tocado por tu piano lo pueda escuchar en la realidad. Gracias. Oscar.

Luigi said...

GGGUUUUUAAAAAAUUUUUUUU

Que temazo marian !!

Muchas gracias

Juansh said...

Yo soy de los herejes a los que les gusta la época de collins cantante.

Porqué? Porque el progresivo de Gabriel era muy interesante pero me transmitía tanto como una tortuga pajera. Y prefiero que me sacuda a tener que pasar 20 minutos analizando para disfrutarlo. Será que soy berreta :P

bonito lunch said...

me gusta genesis con anthony phillips,con gabriel ,sin gabriel y con hackett ,sin hackett ya trio .me gustan todas las variantes.
tambien me he comprado discos solistas de anthony phillips , de gabriel, de hackett(buenisimos los tres primeros) de tony banks, de philco , de rutherford(mike and the mecanics(medio garcha)
como veras me gusta muchisimo
un saludo

Roedor said...

Genesis era una banda de chicos bien de un colegio exclusivísimo de Inglaterra, y Collins fue el primer "plebeyo" que se ganó el lugar porque sabía tocar la batería y cantar. Se nota que era un "diferente".

Genesis es parte importante del soundtrack de mi adolescencia, esa mezcla de melancolía, ironía, cosa juguetona, fantasía y una pizca de maldad. La era Gabriel, que, como dice juansh, era medio friona me gusta mucho, pero aun en sus discos más orientados al mercado, Genesis siempre fue Genesis, y espero que lo siga siendo en este regreso.

El único al que le seguí el paso fue a Hackett, de hecho lo vi en vivo dos veces y me despeinó. Tengo todos sus discos, algunos de ellos difíciles de conseguir hasta en la mula. Esa guitarra me mata.

A Collins lo vi en vivo hace unos años en River, y el muy pillo salió solo al escenario, movió un ratito los dedos ante una especie de timbales tipo barriles de petróleo, tiró todo a la miércoles y no agarró nunca más los palillos en todo el recital. Tiene canciones lindas, de todos modos. Paradójicamente, la versión de Carpet Crawl de Seconds Out, cantada por él, todavía hoy me produce piel de gallina después de 3.000 escuchadas, pero no la original de Gabriel en The Lamb.

Puedo seguir un rato largo, pero mejor me voy al fono a esperar que pongan a la venta las entradas, si es que vienen.

bonito lunch said...

roedor; lo vi a steve la primera vez que vino abril del 93 gran rex.
vino otra vez mas o ud lo vió en otro lado?como se imaginará tengo el programita guardado

Roedor said...

Vino hace relativamente poco, quizás dos años o por ahí. No recuerdo. Cuando voy a esa clase de recitales (como cuando fui a ver a Pat Metheny todas las veces, por ejemplo), es como que floto a diez centímetros del piso y la ciudad es una virtualidad absoluta.

Roedor said...

Me olvidaba: hermosa versión.

Roedor said...

Mención especial para Anthony Phillips, primo hermano de Mike Rutherford y apartado por propia voluntad del grupo porque "no se banca el stress de las giras", y en ese momento a Genesis lo conocían máximo 3.000 tipos...

Grabó muchos discos solitas, también tengo unos cuantos, un par de ellos con guitarristas argentinos. Beyesssssaaa, como diría el Bamba.

Pero basta de desvirturar blogs ajenos. Sucede que Genesis es un sentimiento.

Javier said...

Aayy... the carpet crawlers... hold on my heart... many too many... me diste ganas de escuchar Genesis!

Sobre todo el disco We Can't Dance que es uno de los que a mí más me gusta! (excepto por el obligado hit "I can't dance", tampoco me gusta :S)

Beso, Marian!

Tucho said...

Tarde pero seguro.

Cada día cantás mejor, Marian.
Felicitaciones de vuelta, somos pocos los que tenemos ese talento (jaja).

Mientras, seguimos esperando la multitudinaria versión de Alanis.

Salutes

Huinca said...

Hola Marian,
no entendi del todo tu post, pero aca van mis 2 centavos. Existe un libro llamado Invisible Touch? De quien? De que año?

Es una barrileteada gigantesca eso de los "regresos" de las bandas. Lo de Soda ya estaba claro que era comercial desde el primer minuto (Gran concierto "Chau Soda", disco, ahora gran concierto "Hola Soda", disco = $$$).
Lo de The Police es patetico, ni lo voy a calificar.
Genesis es curioso porque en realidad fueron 2 bandas totalmente diferentes pre- y post-Gabriel. A mi me gusta mas post- (el disco Mama, que fue justo el que no mencionaste, es indiscutiblemente el mejor) pero despues Phil Collins aburrio muchisimo con su carrera solista y ahora no me mueve un pelo que se junte con la banda para seguir haciendo guita.
No se, en resumen creo que cada banda tiene su momento y su contexto y en estos 3 casos son bandas netamente de los 80 que hoy lo unico que prentenden al juntarse de nuevo es hacer GUITA.
Saludos,
Val

El Keyser said...

Cuando a mis 10 años, apagaba la luz de mi cuarto y en mi tocadisco sonaba "Mama"... me acuerdo que me temblaba el cuerto apenas escuchaba la risa esquizofrénica de Collins que después repetía en horas de clase y me costó varias advertencias por parte de mis maestros...

Muy linda versión.

bonito lunch said...

hay un disco que se llama mama?

marian's audiolog said...

nop. el disco que tiene la canción mama se llama genesis.

es el que tiene las formitas medio amarillas en la tapa.... y ahí también está home by the sea....

Roedor said...

Ese es un buen disco, salvo la patinada del Illegal Alien.

juansh said...

Che, parece que también se juntan the who, smashing pumpkins, las SPICE GIRLS y algun par más!!!!!

Tal vez es la anti-moda de lo que se dio algunos años, que consistía en que las bandas eran sólo una excusa para saltar en la carrera solista...

Oscar said...

Coincido con roedor que la versión de "The carpet crawlers" del "Second out" es mucho más impresionante que la original cantada por Peter.
Además quería contarles que siempre recuerdo que allá por el 93 cuando Hackett vino a la Argentina fue entrevistado en canal 13 en el programa 360 y luego antes del corte pusieron el video clip de "Follow you, follow me... que chistosos!
Por mi parte como ya decía antes prefiero el Genesis de los 70, pero de solista siempre seguí a Phil.